Medical Device Link.

MOLECULAR DIAGNOSTICS

A lab technician evaluates PCR results using an iCycler by BioRad and a GenAmp 5700 sequence detector by Roche Molecular Systems. (Photo Courtesy Iris international inc.)

Diagnostic immunoassays can detect targets as dilute as a few million molecules per milliliter. However, many plasma proteins, including potential diagnostic markers and drug targets, may be present below this threshold.

The polymerase chain reaction (PCR) and other amplification methods can detect specific nucleic acid sequences at the single-copy level. A combination of immunoassay and PCR methodologies can, therefore, theoretically detect proteins and intact organisms at a sensitivity approaching that of its detection of nucleic acids.

The underpinnings of this strategy, which is known as immuno-PCR (IPCR), were first described in 1992.¹ This amplified DNA–immunoassay approach is similar to that of an enzyme immunoassay, which makes use of antibody binding reactions and intermediate washing steps. In the updated method, the enzyme label is replaced with a strand of DNA and detected by PCR amplification.

The early IPCR method described the detection of bovine serum albumin adsorbed onto microtiter plate wells through contact with a series of substances—antibody, followed by protein A-avidin chimera, and then biotinylated plasmid DNA. Detection by ethidium bromide–stained gels was semiquantitative. The extensive intermediate washing steps resulted in a cumbersome and lengthy process. In addition, the nonspecific binding of template DNA created background signal, which limited sensitivity. The resulting amplification products also produced significant contamination and a false-positive hazard, common to all DNA amplification– based assays. Even so, the IPCR inventors clearly demonstrated the detection of several hundred copies of protein, far eclipsing the sensitivity of the best radioimmunoassay or enzyme-linked immunosorbent assay (ELISA). Still, despite its analytical promise, IPCR has since been largely ignored.

The Evolution of IPCR

In 1993, a five-order improvement in sensitivity was reported over a control ELISA for the IPCR detection of human protooncogene ETS1 absorbed onto Immulon-4 strips.² A biotinylated 2.5-Kb Klenow fragment was used as the detection molecule. The DNA label in this case was coupled to streptavidin and attached to the primary antibody through a biotinylated secondary antibody.

Several investigators have also achieved highly sensitive IPCR in a sandwich immunoassay format by using reporter antibody labeled with a DNA molecule, and a capture antibody coating the surface of a microtiter well, bead, or particle.³ Human thyroid-stimulating hormone or chorionic gonadotropin is immobilized by specific binding to microtiter plate wells. The bound antigen is further complexed with reporter antibody labeled directly with a molecule of DNA. Washing between steps with detergent solution is required to remove nonspecifically bound conjugate. The amount of DNA label remaining associated with the microtiter well is assessed by PCR amplification, followed by gel electrophoresis and ethidium bromide staining. Detection limits for the sandwich IPCR assay format exceed those of conventional enzyme immunoassays by two to three orders of magnitude. In addition, researchers have explored two-antibody sandwich IPCR for the detection of several antigens with similar improvement over conventional sandwich ELISAs.⁴

A sandwich format of IPCR for the detection of multiple analytes has also been described.⁵ In this research, DNA labels of varying length were attached to multiple reporter antibodies to distinguish the presence of more than one antigen in a sample. The multiple DNA labels were detected simultaneously in the assay by observing the size of the PCR amplification product revealed by gel electrophoresis. As with all heterogeneous IPCR assays, stringent washing of the solid support was required to limit background signal from nonspecifically bound label DNA.

More recently, researchers have taken advantage of the presence of multiple copies of p24 antigen over RNA and have developed a real-time IPCR assay for the detection of HIV-1.⁶ In this instance, a commercial ELISA test employing coated TopYield strips from Nalge Nunc International (Rochester, NY), biotinylated reporter antibody, and streptavidin-HRP label was enhanced by the addition of 500 base pairs (bp) of biotinylated DNA and then subjected to real-time PCR. Direct nucleic acid amplification could detect about 50 copies/ml. The IPCR assay of diluted samples was able to detect the equivalent of 1.7 viral RNA/ml, with a range of three orders of magnitude.

The ability to use any sequence as the label DNA for IPCR has led researchers to investigate a unique approach to IPCR.⁷ Sandwich antibodies are labeled with one of a matched pair of oligonucleotides. The antibodies bind to antigen in proximity to one another. The oligonucleotide strands are complementary for only several bases on the free 3′ ends and they overlap, or hybridize, under appropriate conditions. Overlapping strands are self-priming for PCR at both 3′ sites and will each extend in the presence of DNA polymerase and nucleotide triphosphate. The DNA strands can only extend when overlapped, and overlapping occurs when the labeled antibodies are bound in proximity on an antigen.

The completed strands from the extension of each overlapping end represent new sequences that were not initially present on the antibody. The new sequences may then be exponentially amplified by the inclusion of downstream primers. Since the true DNA template is created only in response to the first chain extension in a sealed well, each individual Ab-DNA conjugate reagent cannot contribute to contamination. In addition, Ab-DNA conjugates composed of overlapping sequences exhibit much-reduced background signal after washing. Although these conjugates can bind nonspecifically to a solid support, this process is random. Background signal in this format requires the proximal nonspecific binding of two molecules, not just one.

In a similar approach called proximity probing, scientists have employed DNA aptamers such that proximal binding to platelet-derived growth factor B-chain (PDGF-BB) enhances enzymatic ligation.^8,9 The ends of the DNA hybridize to a common splint template, effectively creating a 10-bp-overlap oligonucleotide structure. This structure is treated with T4 DNA ligase, then amplified by PCR in the presence of primers and detected in real time with TaqMan probes from Applied Biosystems (Foster City, CA). As few as 24,000 molecules of PDGF-BB were detected, an improvement of 3 log orders over a standard sandwich ELISA.

The Nucleic Acid Detection Immunoassay

Overlapping oligonucleotide labels have been synthesized and used to produce conjugates of monoclonal sandwich antibodies for detecting a solution-phase antigen in a homogeneous format. This helps avoid the use of a capturing support and eliminates washing steps. The paired antibodies bind to separate epitopes on the antigen molecule at a distance that allows some fraction of the oligonucleotide labels to hybridize and extend in the presence of polymerase. The newly formed sequences are detected by real-time PCR. An affinity-purified polyclonal antibody has also been conjugated to demonstrate the detection of intact Escherichia coli 0157 cells by proximity binding to an antigen-embedded surface.

Methods

Prostate-specific antigen (PSA) and sandwich-paired monoclonal antibodies were obtained from BiosPacific Inc. (Emeryville, CA). Polyclonal antibody to Escherichia coli 0157 was obtained from KPL Inc. (Gaithersburg, MD). Oligonucleotides of 60 bases were synthesized to contain a functional amine attached to the 5′ end through a 12- carbon spacer arm from Glen Research Corp. (Sterling, VA) and purified by preparative polyacrylamide gel electrophoresis. The 5′ amino function was activated with a 100-fold excess of disuccinimidyl suberate to minimize cross-linking. The intermediate was rapidly purified by gel-filtration fast protein liquid chromatography (FPLC) in 5 mmol sodium citrate (pH 5.4) in order to maintain the second succimidyl function. The DNA was concentrated by centrifugal ultrafiltration at 4°C and combined immediately at room temperature with 10 mg/ml antibody in 0.3 mol phosphate buffer (pH 8) and 0.45 mol NaCl for 1 hour. Unreacted antibody was removed by size-exclusion FPLC using a Superose S-200 column from GE Healthcare (Piscataway, NJ) that had been equilibrated in Tris-buffered saline (pH 7.4). Unreacted oligonucleotide was removed by anion-exchange FPLC using a Mono Q column from GE Healthcare and 5%/min salt-gradient elution to 1 mol in 20 mmol Tris (pH 7.4). Typically, 50% of the protein was recovered as conjugate.

Figure 1. Using threshold cycle to measure MAb labeled with DNA. The label does not interfere with antigen binding.

Both native and sodium dodecyl sulfate (SDS) gel electrophoresis revealed the presence of antibody containing predominantly one or two strands of 60-mer. An overall MAb-DNA ratio of 1:1.6 was confirmed by absorbance ratio at 260 and 280 nm. Figure 1 shows the results of real-time PCR of a dilution series of MAb directly labeled with an oligonucleotide template strand. The presence of covalent antibody does not interfere with PCR signal. Likewise, the DNA label does not obstruct binding to antigen, as determined by HRP-labeled second-antibody detection of solid-phase antigen.

Oligonucleotides of 60 bases having the following sequences were used to form three DNA-antibody conjugates:

(a) 5′ NH3-C12-GCTACGGCTA GATCGTGTCCATGCGCTTAC GACTTCGATGCTCGGCTCGC TAGCTAGATG-3′

(b) 5′ NH3-C12-TCTCCAACTCTT CAACGCCATGTTCTTATGATAC GAGAGATTCAGCGGAGGCATC TAGCT-3′

(c) 5′ NH3-C12-TCTCCAACTCTT CAACGCCATGTTCTTATGATAC GAGAGATTCATCATCTAGCTAGC GAG-3′

Oligonucleotide sequence (a) is complementary to the other sequences, (b) and (c), for the last 9 and 15 bases, respectively, at the 3′ ends. The overlapping duplex has a specific Gibbs free energy (DG), which is controlled by the nearest neighbor base sequence.¹⁰ The overlaps of 9 and 15 base pairs have basic melt temperatures of 26 and 42°C in 50 mmol NaCl. The overlapping strands hybridize (>50% duplex) when present in solution at concentrations greater than 50 nmol at 25°C equilibrium. The strands exist predominately as monomers (<50% hybrid) in concentrations of less than 100 pmol at equilibrium.

Figure 2. A depiction of the first-chain extension. The new base pair (bp) DNA duplex includes new sequences.

According to the principles of thermodynamics, such DNA strands may transition between single- and double-stranded form as a function of temperature, concentration, and salt effects. When hybridized, each strand 3′ end can serve as the starting point for replicating the other strand. Each strand will extend in the presence of DNA polymerase and nucleotide triphosphates, resulting in a DNA duplex of 111 or 105 base pairs. The newly formed duplex contains sequences that were not present initially in the partially overlapped structure (see Figure 2). These new sequences can be replicated exponentially by PCR in the presence of two downstream primers—5′ GCTACGGCTAGATCGTGTCCA 3′ and 5′ TCTCCAACTCTTCAACG CATGTTC 3′. The initial oligonucleotide label strands cannot replicate in the presence of these primers without forming the first chain-extension product.

The first chain extension was performed at room temperature in the presence of Taq polymerase from Invitrogen Corp. (Carlsbad, CA) and dNTPs for 3 minutes. Real-time PCR was then performed using an iCycler iQ from Bio-Rad Laboratories Inc. (Hercules, CA) in the presence of 200 nmol downstream primers, 1:30,000 SYBR Green from Invitrogen, and 10 nmol fluorescein. Thermocycling was performed for 45 iterations of 1-minute extension at 62°C and 15 seconds denaturation at 95°C. The reaction volume was 50 µl.

Figure 3. Real-time PCR amplification of 9 and 15 base pair overlapping double-stranded DNA (dsDNA).

Figure 3 shows the real-time PCR amplification of the overlapping oli- gonucleotide strands of 9 and 15 base pairs. It can be seen that amplification does not occur until a sufficient concentration of strands are present in the solution to ensure the probability that one strand will be close enough to a complementary strand for hybridization and first-chain extension. Increasing the concentration of overlapping strands results in an exponential increase in template generation, as measured by real-time PCR threshold cycle. Conversely, diluting the concentration decreases the signal exponentially. Amplification of a normal 60-mer template is shown for comparison.

Procedures and Results

Figure 4. A graphic depiction of the homogeneous nucleic acid detection immunoassay (NADIA) process.

Homogeneous Format. Anti-PSA MAb1 has been labeled with oligonucleotide sequence (a), and MAb2 has been conjugated to sequences (b) and (c), using the methods previously described. A schematic representation of a homogeneous nucleic acid–detection immunoassay (NADIA) is given in Figure 4. The conjugate pair was diluted to 10–100 pmol in 10 mmol Tris (pH 8.0) containing 0.1% bovine serum albumin (BSA) and combined in the presence of PSA for 2 hours. The solution was then diluted with Tris/BSA to reduce the bulk conjugate concentration to below 1 pmol and was held at 52°C for 1 minute to fully melt unbound conjugate. PCR reagent mixture, containing Taq polymerase and downstream primers, was added, and the reaction was sealed. The temperature was lowered to 23°C to fully hybridize the DNA strands associated with the immune complex and to initiate the first chain extension. Free MAb-DNA cannot hybridize to the same degree in the time frame of the first extension in dilute solution, and cannot participate in subsequent exponential amplification. The overlapping DNA labels that were associated with the PSA immune complex were extended for 5 minutes, and completed by ramping the temperature to 85°C over 3 minutes. Real-time PCR amplification of the formed template was begun immediately, destroying the immune complex, which is no longer needed.

Figure 5. Results of an assay of prostate-specific antigen (PSA) by homogeneous NADIA. Sensitivity is approximately 100 fg/ml.

Figure 5 shows the results of the assay of PSA in a homogeneous NADIA format employing 15 base pair–overlapping MAb-DNA conjugates. The sensitivity was determined to be about 100 fg/ml. This represents about 500 molecules of PSA in the PCR reaction after the dilution step. The dilution step reduces the signal in a linear fashion, but reduces background exponentially, thus increasing the ratio of signal to noise (see Figure 3).

Results using the nine base pair–overlapping conjugates were similar when temperature conditions were adjusted for a lower melting temperature.

Heterogeneous Format. Affinity-purified polyclonal antibodies to Escherichia coli 0157 have also been conjugated to the overlapping oligonucleotide strands in order to demonstrate a heterogeneous NADIA format for the detection of intact microorganisms. The cell surface is estimated to exhibit several thousand copies of the specific antigen. Calculations show that the distance between randomly distributed sites should fall within the spanning distance of overlapping oligonucleotides conjugated to anti-Escherichia coli 0157. In this case, proximity binding is due to individual antigen spacing, as opposed to separate epitopes on a single protein antigen.

Figure 6. Results of a NADIA assay of live Escherichia coli with 9 and 15 base pair overlapping Ab-DNA.

Polyclonal anti-Escherichia coli 0157 was labeled in three separate reactions with the three oligonucleotide sequences and maintained as individual conjugates. Escherichia coli 0157:H7 was obtained from ATCC 700728 and grown at 37°C. Cells from liquid culture were diluted in fresh media and incubated with 10 nmol of overlapping oligonucleotide-Ab conjugates for 1 hour at room temperature. The resulting cell-antibody complex was washed free of excess, unbound conjugate by centrifugation and was resuspended in cold Tris-buffered saline, effectively diluting the overlapping antibody reagent to below 1.0 pmol. The washed cells were simultaneously streaked onto plates and assayed by incubation in PCR reagent mixture for 10 minutes at 33°C, followed by 40 cycles of real-time PCR in the presence of downstream primers. The presence of 10–50 cells, as determined by colony formation in overnight culture, was sufficient to elicit signal above background in a 2–3 hour assay (see Figure 6).

Streptavidin Model System

The first chain extension of overlapping DNA labels in the NADIA assay appears to be highly inefficient. Well under 1% of the input antigen molecules result in the formation of a template sequence. In theory, every antigen molecule should result in the formation of a sandwich immune complex and should produce an amplifiable sequence if the label strands can overlap and extend to form the new primer binding sites. A three-dimensional spatial analysis of a PSA sandwich complex reveals that such a structure may not be able to be spanned by every label.

Insufficient oligonucleotide length was investigated as a possible limitation by employing a smaller immune complex model consisting of streptavidin labeled with one each of overlapping 60-mer sequences biotinylated on the 3′ ends. Incomplete first-chain extension due to steric hindrance was also tested as a possible limitation by employing 3′–5′ overlap labels. A single first-chain extension occurs away from the center of mass to create a new primer-binding site and a novel template in this orientation.

Such a construct, when subjected to first-chain extension and subsequent PCR, yielded thresholds slightly less than those observed for the equivalent amount of actual double-stranded template. There was little difference between the 3′–3′ and 3′–5′ orientations. The efficiency of first-chain extension was improved to around 50%, allowing for the detection of a few hundred copies of complex in a homogeneous assay. These observations indicate that if DNA label chain length is sufficient to easily span a sandwich immune complex, overlap and first-chain extension will occur efficiently. The assay sensitivity of a homogeneous format then becomes limited predominantly by nonspecific (i.e., thermodynamic) overlap occurring in the bulk antibody reagent. Reduction of nonspecific signal generation by the use of low conjugate concentration (1–10 pmol) must be balanced against kinetics and equilibrium of sandwich complex formation in solution.

Efforts are under way to use oligonucleotide labels containing multiple spacer phosphoramidite 18 molecules from Glen Research Corp. on the 5′ ends to effectively increase chain length, and to employ Fab and F(ab′)2 fragments to diminish immune complex size.

Conclusion

Ed Jablonski is vice president, research and development, and Tom Adams is chief science officer at Iris International Inc. (Chatsworth, CA). The authors can be reached at ejablonski@leucadiatechnologies.com and tadams@leucadiatechnologies.com, respectively.

In the detection of protein antigen in any format, the sensitivity of IPCR can never match the absolute detection of a nucleic acid sequence on a molecule-per-molecule basis. This is because an immunoassay detects a binding reaction, which has specific and nonspecific pathways. The presence of a nonspecific pathway sets the limit of detection. The enhanced sensitivity of IPCR is manifested in its ability to detect nonspecific interactions that would otherwise be unobserved with traditional label molecules. The advantage of IPCR over the direct detection of a nucleic acid sequence for an infectious organism or disease state would be the overwhelming abundance of specific protein molecules over a specific nucleic acid sequence.

NADIA may represent a major advancement in diagnostic technology. The addition of a proximity-binding condition for either a solid- or solution-phase assay introduces another level of discrimination unavailable in other assay formats. The advantages include sensitivity, range of response, and high throughput in microtiter plate arrangement. NADIA has the potential to detect a few hundred copies of protein molecules or a few intact cells using relatively simple homogeneous protocols. The use of real-time PCR instrumentation has become routine, and assays can be formatted to work on systems such as those developed by Cepheid (Sunnyvale, CA) or Roche Diagnostics (Indianapolis). Other amplification systems such as transcription-mediated amplifica- tion (TMA), strand-displacement amplification (SDA), and nucleic acid sequence–based amplification (NASBA) isothermal assays could be used in handheld devices. The immune components are available. Both monoclonal sandwich pairs and affinity-purified polyclonal antibodies to many protein antigens, toxins, and cells have been developed.

---